BBa_B2101 1 BBa_B2101 T7 RBS 0.3 + SapI (rev) 2006-09-27T11:00:00Z 2015-08-31T04:07:21Z The RBS is taken from the wild-type bacteriophage T7 genome. Please see part B2001 for more information. This version of the T7 0.3 RBS is designed for construction via Heather Keller's alternative assembly plan using XbaI and SapI for RBS/CDS assembly without a mixed site. Contains the -20 to -1 region of gp0.4 from the wild-type T7 genome. Can also be used with Standard BioBricks assembly, although this will add a 7 amino acid fusion to the N-terminus of the resulting protein. false false _11_ 0 571 10 Not in stock false This RBS is designed to be compatible with Heather Keller's RBS assembly scheme for creating RBS/CDS junctions without a mixed site. For use in this scheme, this part should be cut with XbaI and SapI. It must be used with a coding sequence containing the SapI site at the 5' end. This part is not compatible with CDSs that use a GTG site and must be used with CDSs using an ATG start site. The two bp spacer on the 3' end also allows this part to be used in standard biobricks assembly and is necessary to maintain the reading frame of a downstream CDS. Note that Standard Biobricks Assembly with this part results in the creation of a new ATG start site, and a 7 amino acid fusion at the N terminus of the downstream protein. CDSs with alternative start sites are compatible with this part via Standard Assembly. This part was inadvertently constructed without the single base pair (G/C) that separates the XbaI site and the 5' end of the part. false Heather Keller component2218355 1 BBa_B2001 annotation2218355 1 BBa_B2001 range2218355 1 1 20 BBa_B2001 1 T7 0.3 T7 RBS 0.3 2006-09-26T11:00:00Z 2015-08-31T04:07:21Z T7+ genome RBS upstream of gene 0.3 Test RBS from T7 that may be used in E.coli false true _11_ 0 571 10 Not in stock false None false Heather Keller annotation1902503 1 SD region range1902503 1 8 12 BBa_B2001_sequence 1 actgcacgaggtaacacaag BBa_B2101_sequence 1 actgcacgaggtaacacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z