BBa_C2003 1 BBa_C2003 Homodimeric zinc finger 2006-05-31T11:00:00Z 2015-08-31T04:07:25Z false false _41_ 0 126 84 Not in stock false false Reshma Shetty annotation1878162 1 domain linker range1878162 1 151 177 annotation1878158 1 Zif268 zinc finger 2 range1878158 1 7 90 annotation1878159 1 Zif268 zinc finger 3 range1878159 1 91 150 annotation1878163 1 double stop codon range1878163 1 283 288 annotation1878161 1 GCN4 leucine zipper range1878161 1 178 264 annotation1878164 1 start codon range1878164 1 1 3 annotation1878160 1 hexaHis tag range1878160 1 265 282 BBa_C2003_sequence 1 atgaagcccttccagtgtcgaatctgcatgcgtaacttcagtcgtagtgaccaccttaccacccacatccgcacccacacaggcgagaagccttttgcctgtgacatttgtgggaggaagtttgccaggagtgatgaacgcaagcgtcatcgggatattcagcatattcttcctattcttgaagacaaggttgaagaattgctttcgaaaaattatcacttggaaaatgaggttgccagattaaagaaattagttggcgaacgccatcaccatcaccatcactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z