BBa_C2034 1 BBa_C2034 Zif268 fingers 2 and 3 2008-05-04T11:00:00Z 2015-08-31T04:07:25Z Original template provided by Scott Wolfe. Encodes zinc finger domain Zif268 fingers 2 and 3. false false _41_ 0 126 162 Not in stock false This part has a modified BioBrick suffix in which the single T prior to the SpeI site has been deleted to facilitate in frame protein fusions during BioBrick assembly. false Reshma Shetty annotation1962347 1 Finger 3 range1962347 1 91 155 annotation1962346 1 Finger 2 range1962346 1 7 90 annotation1962348 1 DNA binding domain range1962348 1 1 155 BBa_C2034_sequence 1 atgaagcccttccagtgtcgaatctgcatgcgtaacttcagtcgtagtgaccaccttaccacccacatccgcacccacacaggcgagaagccttttgcctgtgacatttgtgggaggaagtttgccaggagtgatgaacgcaagaggcatcgcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z