BBa_C2040 1 BBa_C2040 p53ZF fingers 1 and 2.Fos 2008-05-04T11:00:00Z 2015-08-31T04:07:25Z Composite part of BBa_C2034 and BBa_C2030 using non-standard BioBrick assembly (similar but not identical to the Silver lab fusion technique). Encodes a zinc finger-leucine zipper fusion. The zinc finger domain is fingers 1 and 2 of p53ZF and the leucine zipper domain is Fos. false false _41_ 0 126 162 Not in stock false In frame assembly. false Reshma Shetty annotation1962366 1 Synthetic transcription factor range1962366 1 1 297 annotation1962353 1 Double TAA stop codon range1962353 1 292 297 annotation1962350 1 Zinc finger 2 range1962350 1 97 156 annotation1962349 1 Zinc finger 1 range1962349 1 7 96 annotation1962351 1 Fos leucine zipper (uniprot) range1962351 1 181 267 annotation1962352 1 Start codon range1962352 1 1 3 annotation1962356 1 Dimerization domain range1962356 1 163 297 BBa_C2040_sequence 1 atgaagccgtacgcatgtccagtagaaagctgtgaccgtcgcttctcaacgaagcagcaccttaaggagcacatccgtattcacaccgggcaaaaaccgtttcaatgccgcatttgtatgcggaatttctcacagcgcggcacccttacccgccatcgcaaactagagcacactgatacactccaagcggagacagaccaactagaagatgagaagtctgctttgcagaccgagattgccaacctgctgaaggagaaggaaaaactagagttcatcctggcagctcaccgataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z