BBa_C2041 1 BBa_C2041 p53ZF fingers 1 and 2.JunB 2008-05-04T11:00:00Z 2015-08-31T04:07:25Z Composite part of BBa_C2034 and BBa_C2031 using non-standard BioBrick assembly (similar but not identical to the Silver lab fusion technique). Encodes a zinc finger-leucine zipper fusion. The zinc finger domain is fingers 1 and 2 of p53ZF and the leucine zipper domain is JunB. false false _41_ 0 126 162 Not in stock false In frame assembly. false Reshma Shetty annotation1962360 1 Dimerization domain range1962360 1 163 294 annotation1962357 1 Finger 2 range1962357 1 97 156 annotation1962354 1 Start codon range1962354 1 1 3 annotation1962359 1 Double TAA stop codon range1962359 1 289 294 annotation1962358 1 JunB leucine zipper range1962358 1 181 267 annotation1962355 1 Finger 1 range1962355 1 7 96 BBa_C2041_sequence 1 atgaagccgtacgcatgtccagtagaaagctgtgaccgtcgcttctcaacgaagcagcaccttaaggagcacatccgtattcacaccgggcaaaaaccgtttcaatgccgcatttgtatgcggaatttctcacagcgcggcacccttacccgccatcgcaaactagagcacatcgcgcgcctggaggacaaggtgaagacgctcaaggccgagaacgcggggctgtcgagtaccgccggcctcctccgggagcaggtggcccagctcaaacagaaggtcatgacccactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z