BBa_C2043 1 BBa_C2043 Zif268 fingers 2 and 3.Fos 2008-05-04T11:00:00Z 2015-08-31T04:07:25Z Composite part of BBa_C2034 and BBa_C2030 using non-standard BioBrick assembly (similar but not identical to the Silver lab fusion technique). Encodes a zinc finger-leucine zipper fusion. The zinc finger domain is fingers 2 and 3 of Zif268 and the leucine zipper domain is Fos. false false _41_ 0 126 162 Not in stock false In frame assembly. false Reshma Shetty annotation1962370 1 Finger 2 range1962370 1 7 90 annotation1962372 1 Double TAA stop codon range1962372 1 286 291 annotation1962373 1 Leucine zipper (uniprot) range1962373 1 175 261 annotation1962369 1 Start codon range1962369 1 1 3 annotation1962371 1 Dimerization domain range1962371 1 157 291 annotation1962374 1 Synthetic transcription factor range1962374 1 1 291 BBa_C2043_sequence 1 atgaagcccttccagtgtcgaatctgcatgcgtaacttcagtcgtagtgaccaccttaccacccacatccgcacccacacaggcgagaagccttttgcctgtgacatttgtgggaggaagtttgccaggagtgatgaacgcaagaggcatcgcaaactagagcacactgatacactccaagcggagacagaccaactagaagatgagaagtctgctttgcagaccgagattgccaacctgctgaaggagaaggaaaaactagagttcatcctggcagctcaccgataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z