BBa_E3030 1 BBa_E3030 FRET acceptor YPet (optimized to work with CyPet (Cyan FP) as donor 2005-03-11T12:00:00Z 2015-08-31T04:07:27Z Nguyen et al, (2005) Nature Biotech Feb 6 Epub PMID: 15696158 Released HQ 2013 YPet YFP, optimized CyPet (Cyan FP) FRET acceptor false false _8_ 0 230 7 In stock false Contains A206K (in this sequence A211K due to N-terminal linker) mutation to reduce dimerization potential as described by Roger Tsien. Contains N- and C-terminal linker sequences (with homology to biobrick parts BBa_E2060 (mCherry), BBa_E2050 (mOrange), and BBa_E2020 (Cerulean CFP) to facilitate color swapping in yeast. Adds N-"MATSG" and "GSGTA"-C. to published amino acid sequence. Inserts a "V" after normal start M. Double TAATAA stop codon. Missing EcoRI, HindIII, NotI, NdeI, XhoI, RsrII, BamHI, NcoI, BglI, SpeI, XbaI, and PstI. Except for 5' and 3' ends no significant sequence identity runs with above biobrick FPs and GFP S65T as found in O'Shea deletion strain collection (originally from plasmid pFA6-GFP(S65T)-His3MX6). false ryu annotation2214025 1 Help:Barcodes range2214025 1 754 778 annotation1436042 1 GSGTA linker range1436042 1 733 747 annotation1436041 1 MATSG linker range1436041 1 1 15 BBa_E3030_sequence 1 atggcaactagcggcatggttagtaaaggagaagaacttttcactggagttgtcccaattctagttgaattagatggagatgtgaatgggcaaaaattctccgtaagcggtgaaggtgagggtgacgctacttatggcaaattgacattaaagcttttgtgtactaccggtaagttaccagttccttggccaactctcgttactacattaggatacggtgttcaatgctttgccagataccccgatcacatgaaacaacatgattttttcaagagtgccatgccagaaggttacgtacaagagaggaccattttctataaagatgacggcaactataagacgagagctgaagtgaagtttgaaggtgatacgctagtaaatcgaatcgagctgaaaggtatagactttaaagaagacgggaatattttgggccataaaatggaatataactataattctcataatgtctacataacagctgacaaacctaagaatggaataaaggcaaacttcaaaatccgtcacaacattaaggatggtggcgtccaattggcggatcactatcaacagaatacaccgattggtgatggaccagttcttttgcctgataaccattacttgtcttatcagtcaaaattatttaaagatcccaatgaaaaaagagaccacatgattctactggagtttcttacagctgctgggattacacatggcatggatgaactatacaaaggttctggtaccgcataataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z