BBa_G00201 1 GFP-r Reverse primer for sequencing composite parts; binds to GFP (BBa_E0040) 2007-03-01T12:00:00Z 2015-08-31T04:07:28Z n/a This is a reverse primer that bind about midway through the GFP coding sequence and extends towards the start codon. false false _11_ 0 135 84 Not in stock false n/a false Bartholomew Canton BBa_G00201_sequence 1 acgtgtcttgtagttcccgtca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z