BBa_G00602 1 BBa_G00602 Forward primer to C0062 2007-03-28T11:00:00Z 2015-08-31T04:07:28Z n/a Binds in the early region of C0062 and sequences in the forward direction false false _11_ 0 135 84 Not in stock false n/a false Bartholomew Canton BBa_G00602_sequence 1 gaatgtttagcgtgggcatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z