BBa_G00700 1 BBa_G00700 Forward primer for I0500 (pBAD) 2004-09-22T11:00:00Z 2015-08-31T04:07:28Z Target sequence located approximately 400bp from the left end of pBAD. Suitable to sequence the final 800bp of pBAD false false _11_6_ 0 135 7 Not in stock false false Barry Canton BBa_G00700_sequence 1 agatttatcgccagcagctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z