BBa_G1000 1 Suffix-F Forward primer for amplifying BioBrick plasmid backbones by PCR (Suffix-f) 2008-04-21T11:00:00Z 2015-08-31T04:07:28Z . This is the FWD primer used in the measurement kit to amplify pSB3K3 false false _11_ 0 2 84 Not in stock false . false Jason Kelly BBa_G1000_sequence 1 tactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z