BBa_I1033 1 BBa_I1033 CI(1) IS10 asRNA 2003-01-31T12:00:00Z 2015-08-31T04:07:29Z see referencers Region which serves as basis for transcription of asRNA that binds to and inhibits <bb_part>BBa_I1010</bb_part>'s mRNA transcript. Part of the XOR gate comprised of <bb_part>BBa_I1010</bb_part> and <bb_part>BBa_I1020</bb_part>, their corresponding asRNA coding sequences (<bb_part>BBa_I1033</bb_part> and <bb_part>BBa_I1023</bb_part>). false false _1_ 0 24 7 Not in stock false References (unparsed) here: <p><A href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&amp;dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</A> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 <P>Case, C., Roels, S., Jense, P., Lee, J., Kleckner, N. and Simons, R. (1989). The unusual stability of the IS10 anti-sense RNA is critical for its function and is determined by the structure of its stem-domain. EMBO 8(13): 4297-4305. <P>Jain, C. (1995). IS10 Antisense Control in Vivo is Affected by Mutations Throughout the Region of Complementarity Between the Interacting RNAs. J. Mol. Biol. 246:585-594. <P>Kittle, J.D., Simons, R.W., Lee, J., and Kleckner, N. (1989). Insertion Sequence IS10 Anti-sense Pairing Initiates by an Interaction Between the 5' End of the Target RNA and a Loop in the Anti-sense RNA. J. Mol. Biol. 210:561-572. <P>Jain, C. (1997). Models for Pairing of IS10 Encoded Antisense RNAs in vivo. J. theor. Biol. 186: 431-439. <P>Lutz, R., and Bujard, H. (1997). Independent and tight regulation of transcriptional units in E. coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Research 25(6): 1203-1210. <P>Ma, C., and Simons, R. (1990). The IS10 antisense RNA blocks ribosome binding at the transposase translation initiation site. EMBO 9(4):1267-1274. <P>E. coli codon usage table at http://bioinfo.weizmann.ac.il:3456/kegg/codon_table/codon_eco.html. <P><BR></P><P> References (unparsed) here: <p><A href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&amp;dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</A> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 <P>Case, C., Roels, S., Jense, P., Lee, J., Kleckner, N. and Simons, R. (1989). The unusual stability of the IS10 anti-sense RNA is critical for its function and is determined by the structure of its stem-domain. EMBO 8(13): 4297-4305. <P>Jain, C. (1995). IS10 Antisense Control in Vivo is Affected by Mutations Throughout the Region of Complementarity Between the Interacting RNAs. J. Mol. Biol. 246:585-594. <P>Kittle, J.D., Simons, R.W., Lee, J., and Kleckner, N. (1989). Insertion Sequence IS10 Anti-sense Pairing Initiates by an Interaction Between the 5' End of the Target RNA and a Loop in the Anti-sense RNA. J. Mol. Biol. 210:561-572. <P>Jain, C. (1997). Models for Pairing of IS10 Encoded Antisense RNAs in vivo. J. theor. Biol. 186: 431-439. <P>Lutz, R., and Bujard, H. (1997). Independent and tight regulation of transcriptional units in E. coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Research 25(6): 1203-1210. <P>Ma, C., and Simons, R. (1990). The IS10 antisense RNA blocks ribosome binding at the transposase translation initiation site. EMBO 9(4):1267-1274. <P>E. coli codon usage table at http://bioinfo.weizmann.ac.il:3456/kegg/codon_table/codon_eco.html. <P><BR></P><P>Complementary to beginning of <bb_part>BBa_I1010</bb_part> transcript covering 5' region, RBS, start codon, and 5 bp into coding sequence. Secondary structure designed for the IS10 anti-sense mRNA mechanism (See below).<P> Can be used with all parts of the BBa_I system. It inhibits BBa_I1010. Incompatible with systems containing cI (wild type) false Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation1899 1 stem_loop range1899 1 58 120 annotation1896 1 reverse complement to cI cds range1896 1 56 63 annotation1893 1 stem_loop range1893 1 79 99 annotation7053 1 BBa_I1033 range7053 1 1 170 annotation1898 1 start range1898 1 61 63 annotation1901 1 start range1901 1 56 56 annotation1902 1 LacO-1 range1902 1 1 55 annotation1900 1 added codon (Cys) range1900 1 58 60 annotation1895 1 Reverse Complement RBS range1895 1 68 73 annotation1892 1 Reverse Complement to cI mRNA range1892 1 56 90 BBa_I1033_sequence 1 ataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcacgagcacatcttgttgtctgattattgatttttcgcgaaaccatttgatcatatgacaagatgtgtatccaccttaacttaatgatttttaccaaaatcattaggggattcatcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z