BBa_I11021 1 BBa_I11021 excisionase from E. coli phage lambda (removes prophage from host genome) 2004-09-02T11:00:00Z 2015-08-31T04:07:30Z Released HQ 2013 Lambda excisionase coding region with AAV degradation tag and two stop codons false false _2_ 0 102 7 In stock false true mschomp annotation1064103 1 AAV range1064103 1 213 249 annotation2214029 1 Help:Barcodes range2214029 1 256 280 annotation1064105 1 cI lambda range1064105 1 1 212 annotation1064104 1 stop range1064104 1 250 256 BBa_I11021_sequence 1 atgtacttgacacttcaggagtggaacgcacgccagcgacgtccaagaagccttgaaacagttcgtcgatgggttcgggaatgcaggatattcccacctccggttaaggatggaagagagtatctgttccacgaatcagcggtaaaggttgacttaaatcgaccagtaacaggtggccttttgaagaggatcagaaatgggaagaaggcgaagtcagcagcaaacgacgaaaactacgctgctgctgtttaataaccctgatagtgctagtgtagatccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z