BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_I12034 1 Prm+ Modified lamdba Prm promoter (repressed by 434 cI with cooperativity) RBS+ 2004-08-05T11:00:00Z 2015-08-31T04:07:31Z Bushman, F. D. The bacteriophage 434 right operator roles of O-R1, O-R2, and O-R3. J. Mol. Biol. (1993) 230, 28-40. Lamdba Prm promoter modified to be activated by lamda repressor (cI) and repressed by 434 repressor (cI) with both activation and repression taking advantage of cooperativity. false false _3_ 0 148 7 Not in stock false The O-R1 region of 434 contained 14 base pairs as opposed to the 17 base pairs of the O-R3 site of lambda. Also, it was noticed that the O-R3 site of the lambda included part of the -10 site. Hence, to preserve the spacing and the -10 site, the three nucleotides that were in both the -10 site and the lambda O-R3 site were retained. The 14 nucleotides that were in the O-R3 site and not in the -10 site were replaced with the O-R1 site of the 434. To allow 434 cI to take advantage of cooperativity and to maintain spacing, the -10 site was left undisturbed, but immediately following, the space was replaced with the OR-2 site of 434 cI. Thus, if 434 cI is present in the system, it will bind to both the OR-1 and OR-2 sites of 434, preventing transcription. However, if there is no 434 cI present, then a portion of the OR-2 site will be included in the mRNA, which should not result in any problems. false ryhsiao annotation1030779 1 OR1 434 range1030779 1 56 69 annotation1030781 1 -10 range1030781 1 71 76 annotation1030773 1 OR1 lambda range1030773 1 9 25 annotation1030774 1 -35 range1030774 1 48 53 annotation1030775 1 OR2 lambda range1030775 1 33 49 annotation1030783 1 BBa_B0034 (Elowitz) range1030783 1 92 103 annotation1030796 1 conserved range1030796 1 96 101 annotation1030782 1 OR2 434 range1030782 1 77 91 BBa_B0025 1 BBa_B0025 double terminator (B0015), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false true _1_ 0 24 7 In stock false true Caitlin Conboy annotation369703 1 B0010 range369703 1 50 129 annotation369702 1 B0012 range369702 1 1 41 BBa_I12031 1 BBa_I12031 Barkai-Leibler design experiment Part A (Lambda cI) wth cooperativity 2004-08-03T11:00:00Z 2015-08-31T04:07:31Z Bushman, F. D. The bacteriophage 434 right operator roles of O-R1, O-R2, and O-R3. J. Mol. Biol. (1993) 230, 28-40. This forms the activator of a Barkai-Leibler oscillator. Differs from BBa_I12000 in that this part includes an extra 434 OR region downstream of the -10 site to allow the repression to take advantage of cooperativity. false false _3_ 0 148 7 Not in stock false This part to work in conjunction with BBa_I12002. This part creates one of the proteins involved in the Modified Barkai-Leibler relaxation oscillator design (activator protein: lambda cI). In the presence of Lambda cI, more Lambda cI will be produced (positively autoregulated). However, if there is 434 cI repressor present in the system, the production of Lambda cI should be repressed. This was implemented in the subpart BBa_I12030, which represents the Operating Regions for the promoter. The fact that the OR-3 site was replaced with the OR-1 site of 434 cI, and that the OR-2 site of 434 cI is included directly after the -10 site should provide enough cooperativity/binding affinity for the lambda cI to be sufficiently repressed when there is 434 cI binding in. false ryhsiao component2221223 1 BBa_C0051 component2221219 1 BBa_I12034 component2221210 1 BBa_B0025 component2221230 1 BBa_B0015 annotation2221210 1 BBa_B0025 range2221210 1 1 129 annotation2221219 1 BBa_I12034 range2221219 1 138 239 annotation2221230 1 BBa_B0015 range2221230 1 1029 1157 annotation2221223 1 BBa_C0051 range2221223 1 246 1020 BBa_C0051 1 cI lam cI repressor from E. coli phage lambda (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). Released HQ 2013 Coding region for the cI repressor based on cI repressor from bacteriophage lambda modified with an LVA tail for rapid degradation of the protein. cI repressor binds to the cI regulator (BBa_R0051).</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P> References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P>BBa_C0051 cI repressor is based on the cI repressor from the Elowitz's repressilator. It has been modified to include a rapid degradation LAA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation23334 1 cI lambda range23334 1 4 711 annotation23335 1 LVA range23335 1 712 744 annotation2213991 1 Help:Barcodes range2213991 1 751 775 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_I12031_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggtactagaggcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagattacaatgtatcttgtaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0051_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I12034_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagattacaatgtatcttgtaaagaggagaaa BBa_B0025_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z