BBa_I12040 1 BBa_I12040 Modified lambda P(RM) promoter: -10 region from P(L) and cooperatively repressed by 434 cI 2004-08-18T11:00:00Z 2015-08-31T04:07:31Z Bushman, F. D. The bacteriophage 434 right operator roles of O-R1, O-R2, and O-R3. J. Mol. Biol. (1993) 230, 28-40. ; Lutz, R & Bujard, H. "Independent and tight regulation of transcriptional units in Escherichia coli via the lacR/O, the TetR/O and AraC/I1-I2 regulatory elements, Nucleic Acids Research, 1997, Vol.25, No.6 (1203-1210) Released HQ 2013 Lamdba P(RM) promoter modified to be activated by lamda repressor (cI) and repressed by 434 repressor (cI). Two operator sites are used for both activation and repression to enhance cooperativity. Additionally, the -10 region from lambda P(L) was used instead of that from P(RM). false false _3_ 0 148 7 In stock false The O-R3 site of lambda (17 nt) was replaced by the O-R1 site of 434 (14 nt) to facilitate repression by 434 cI. The new 434 O-R1 is 5'-justified with the lambda O-R3 it replaced, leaving the -10 sequence intact. The 434 O-R2 site replaces the wildtype labmda promoter starting at -5, thereby preserving the 8 nt between 434 O-R1 and O-R2 in the wildtype. The mRNA transcript will contain an additional 9 nt compared to wildtype lambda phage. <P>This part differs from BBa_I12036 because the -10 region from P(L) was used instead of that from P(RM). true ryhsiao annotation1059303 1 OR2 434 range1059303 1 78 91 annotation1059300 1 -35 range1059300 1 48 53 annotation1059301 1 OR1 434 range1059301 1 56 69 annotation1059299 1 OR2 lambda range1059299 1 33 49 annotation1059298 1 OR1 lambda range1059298 1 9 25 annotation1062263 1 start range1062263 1 83 83 annotation1059302 1 -10 range1059302 1 71 76 BBa_I12040_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtagatacttacaatgtatcttgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z