BBa_C0056 1 BBa_C0056 cI repressor from phage 434 (no LVA) 2004-09-01T11:00:00Z 2015-08-31T04:07:23Z Removed LVA tag from BBa_C0052 Released HQ 2013 -- No description -- false false _41_6_ 0 126 7 In stock false Removed LVA tag from BBa_C0052 via PCR. In pSB1AK3 currently. true Reshma Shetty annotation1063931 1 cI 434 range1063931 1 1 636 annotation1063930 1 2 range1063930 1 631 636 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I12007 1 Prm + Modified lambda Prm promoter (OR-3 obliterated) 2004-07-14T11:00:00Z 2015-08-31T04:07:31Z Shih and Gussin (1983) Released HQ 2013 Lambda Prm promoter modified to be activated but not repressed by the lambda repressor (cI) false true _3_ 0 103 7 In stock false In wild type lambda phage, the OR3 site (-27 to -11) reads "tatcccttgcggtgata" on the sense strand of DNA. To prevent lambda repressor (cI) from binding to this site, the 4th through 10th nt of OR3 were replaced by the 7 nt between OR2 and OR1, "aaatagt" (-57 to -51), which in effect mutates 5 nt of the promoter. These nt were chosen to be about halfway between the -10 and -35 boxes of the promoter. Furthermore, since these nt already act as a spacer in wild-type phage, it is hoped they will not create undesired interactions. true Hans annotation937702 1 OR2 range937702 1 33 49 annotation937705 1 -10 range937705 1 71 76 annotation937701 1 OR1 range937701 1 9 25 annotation937704 1 mutate to obliterate OR3 range937704 1 59 65 annotation937703 1 -35 range937703 1 48 53 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_I12054 1 BBa_I12054 B protein (434 cI) subassembly for modified BL oscillator 2004-09-02T11:00:00Z 2015-08-31T04:07:31Z This part produces 434 cI (B) in presence of lambda cI (A). false false _3_ 0 145 7 Not in stock false false endelman component1241980 1 BBa_C0056 component1241972 1 BBa_B0034 component1241985 1 BBa_B0010 component1241967 1 BBa_I12007 component1241995 1 BBa_B0012 annotation1241995 1 BBa_B0012 range1241995 1 841 881 annotation1241985 1 BBa_B0010 range1241985 1 753 832 annotation1241967 1 BBa_I12007 range1241967 1 1 82 annotation1241972 1 BBa_B0034 range1241972 1 91 102 annotation1241980 1 BBa_C0056 range1241980 1 109 744 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I12007_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt BBa_B0034_sequence 1 aaagaggagaaa BBa_I12054_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgttactagagaaagaggagaaatactagatgagtatttcttccagggtaaaaagcaaaagaatccagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagcttgtgaaccctacgatatcaaggacattgatgaatggtatgacagtgacgttaacttattaggcaatggattctggctgaaggttgaaggtgattccatgacctcacctgtaggtcaaagcatccctgaaggtcatatggtgttagtagatactggacgggagccagtgaatggaagccttgttgtagccaaactgactgacgcgaacgaagcaacattcaagaaactggtcatagatggcggtcagaagtacctgaaaggcctgaatccttcatggcctatgactcctatcaacggaaactgcaagattatcggtgttgtcgtggaagcgagggtaaaattcgtataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0056_sequence 1 atgagtatttcttccagggtaaaaagcaaaagaatccagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagcttgtgaaccctacgatatcaaggacattgatgaatggtatgacagtgacgttaacttattaggcaatggattctggctgaaggttgaaggtgattccatgacctcacctgtaggtcaaagcatccctgaaggtcatatggtgttagtagatactggacgggagccagtgaatggaagccttgttgtagccaaactgactgacgcgaacgaagcaacattcaagaaactggtcatagatggcggtcagaagtacctgaaaggcctgaatccttcatggcctatgactcctatcaacggaaactgcaagattatcggtgttgtcgtggaagcgagggtaaaattcgtataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z