BBa_I12210 1 lac Or2-62 plac Or2-62 (positive) 2004-08-06T11:00:00Z 2015-08-31T04:07:31Z This is a modification of the standard plac operon with everything before the -35 site removed, the Or2 site from the lambda promoter inserted at the beginning, and a 17-bp spacer added between the two. false false _3_ 0 120 7 In stock false false rwald annotation1031724 1 cI OR2 (lambda) range1031724 1 1 17 annotation1031725 1 -35 range1031725 1 35 40 annotation1031727 1 spacer range1031727 1 18 34 annotation1031726 1 -10 range1031726 1 59 65 BBa_I12210_sequence 1 caacacgcacggtgttaaggttctgttaagtaactttacactttatgcttccggctcgtatgttgtgtgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z