BBa_I14033 1 Cat P(Cat) 2004-08-03T11:00:00Z 2015-08-31T04:07:37Z Plasmid pACYC184 Released HQ 2013 Constitutive Promoter, Medium Transcription false false _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1026173 1 -10 range1026173 1 27 32 annotation1026172 1 -35 range1026172 1 4 9 annotation1026174 1 P(Cat) range1026174 1 1 38 BBa_I14033_sequence 1 ggcacgtaagaggttccaactttcaccataatgaaaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z