BBa_C0074 1 penI penI repressor from Bacillus licheniformis (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:23Z bacillus licheniformis Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false Since penI is being ported from Bacillus Licheniformis, the sequence was changed within the coding region to reflect codon usage in E.Coli K12. Codons were mapped to the codon of the same usage rank in E.Coli. true crackdots annotation306563 1 LVA range306563 1 385 417 annotation302638 1 penI range302638 1 1 387 annotation2214009 1 Help:Barcodes range2214009 1 424 448 BBa_I14042 1 BBa_I14042 strong RBS . penI 2004-08-03T11:00:00Z 2015-08-31T04:07:38Z BBa_B0030 BBa_C0074 false false _4_ 0 166 7 Not in stock false false Aditi Shrivastava, Sarah Welch, Jiwon Lee component1023943 1 BBa_C0074 component1023932 1 BBa_B0030 annotation1023943 1 BBa_C0074 range1023943 1 22 444 annotation1023932 1 BBa_B0030 range1023932 1 1 15 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_I14042_sequence 1 attaaagaggagaaatactagatgaaaaaaataccacagatttctgatgcggaactcgaagtcatgaaagtgatttggaagcattcttccattaatactaatgaggtaatcaaagagctcagtaaaacttcaacgtggagcccaaaaactattcagactatgctgctgcgccttatcaaaaaaggcgctctcaaccaccataaagaaggtcgggttttcgtttacacgcctaatatagacgaatcagattatatagaggttaagtcacactcatttctcaaccggttttacaatggtacattaaattccatggtactcaactttttggagaatgatcaactgtcgggagaagaaatcaatgaattgtatcagatactcgaagaacataagaaccgtaagaaggaagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_C0074_sequence 1 atgaaaaaaataccacagatttctgatgcggaactcgaagtcatgaaagtgatttggaagcattcttccattaatactaatgaggtaatcaaagagctcagtaaaacttcaacgtggagcccaaaaactattcagactatgctgctgcgccttatcaaaaaaggcgctctcaaccaccataaagaaggtcgggttttcgtttacacgcctaatatagacgaatcagattatatagaggttaagtcacactcatttctcaaccggttttacaatggtacattaaattccatggtactcaactttttggagaatgatcaactgtcgggagaagaaatcaatgaattgtatcagatactcgaagaacataagaaccgtaagaaggaagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0030_sequence 1 attaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z