BBa_C0071 1 rhlR rhlR repressor/activator from P. aeruginosa PA3477 (+LVA) 2004-01-26T12:00:00Z 2015-08-31T04:07:23Z P. aeruginosa PA3477 Released HQ 2013 Transcriptional regulator, in complex with N-butyryl-HSL, RhlR binds to the Rhl promoter false false _1_ 0 24 7 In stock false (1/28/04 Edit Jamboree) (0) No BB sites (1) ATG (2) TAATAA (3) Blast checks out (4) No codon changes (5) Maybe chassis compatability (check by experiment) (6) Codon usage not optimal (but looks OK) (7) ssrA tag added true Debra Lin, Srini Devadas, David Gray, Ronny Krashinsky, and Chris Zheng Liu, Boopers annotation301192 1 rhlR range301192 1 1 723 annotation306523 1 LVA range306523 1 724 756 annotation2213995 1 Help:Barcodes range2213995 1 763 787 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R1075 1 const. Constitutive Promoter II 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z Gaal, Gourse, et al. constitutive promoter which outputs .4 TIPs point mutants of wild type rrnB promoter P1 false false _1_ 0 24 7 Not in stock false false Chris Walsh (Fighting Darwins) annotation309024 1 -35 range309024 1 15 20 annotation309020 1 -10 range309020 1 35 40 BBa_I2011 1 BBa_I2011 B_Receiver Device (R1075, B0034.C0071.B0015) 2004-01-27T12:00:00Z 2015-08-31T04:07:39Z constitutive promoter, RBS, rhlR coding region, terminator rhlR protein binds AI-2 chemical signal to induce operator false true _1_ 0 24 7 Not in stock false false Alvin Carter Powers (Fighting Darwins) component947411 1 BBa_C0071 component947427 1 BBa_B0012 component947401 1 BBa_B0034 component947396 1 BBa_R1075 component947417 1 BBa_B0010 annotation947401 1 BBa_B0034 range947401 1 58 69 annotation947396 1 BBa_R1075 range947396 1 1 49 annotation947417 1 BBa_B0010 range947417 1 871 950 annotation947427 1 BBa_B0012 range947427 1 959 999 annotation947411 1 BBa_C0071 range947411 1 76 837 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R1075_sequence 1 ttaaatttcctcttttcaggccggaataactccctataatgcgccacca BBa_B0034_sequence 1 aaagaggagaaa BBa_I2011_sequence 1 ttaaatttcctcttttcaggccggaataactccctataatgcgccaccatactagagaaagaggagaaatactagatgaggaatgacggaggctttttgctgtggtgggacggtttgcgtagcgagatgcagccgatccacgacagccagggcgtgttcgccgtcctggaaaaggaagtgcggcgcctgggcttcgattactacgcctatggcgtgcgccacacgattcccttcacccggccgaagaccgaggtccatggcacctatcccaaggcctggctggagcgataccagatgcagaactacggggccgtggatccggcgatcctcaacggcctgcgctcctcggaaatggtggtctggagcgacagcctgttcgaccagagccggatgctctggaacgaggctcgcgattggggcctctgtgtcggcgcgaccttgccgatccgcgcgccgaacaatttgctcagcgtgctttccgtggcgcgcgaccagcagaacatctccagcttcgagcgcgaggaaatccgcctgcggctgcgttgcatgatcgagttgctgacccagaagctgaccgacctggagcatccgatgctgatgtccaacccggtctgcctgagccatcgcgaacgcgagatcctgcaatggaccgccgacggcaagagttccggggaaatcgccatcatcctgagcatctccgagagcacggtgaacttccaccacaagaacatccagaagaagttcgacgcgccgaacaagacgctggctgccgcctacgccgcggcgctgggtctcatcgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0071_sequence 1 atgaggaatgacggaggctttttgctgtggtgggacggtttgcgtagcgagatgcagccgatccacgacagccagggcgtgttcgccgtcctggaaaaggaagtgcggcgcctgggcttcgattactacgcctatggcgtgcgccacacgattcccttcacccggccgaagaccgaggtccatggcacctatcccaaggcctggctggagcgataccagatgcagaactacggggccgtggatccggcgatcctcaacggcctgcgctcctcggaaatggtggtctggagcgacagcctgttcgaccagagccggatgctctggaacgaggctcgcgattggggcctctgtgtcggcgcgaccttgccgatccgcgcgccgaacaatttgctcagcgtgctttccgtggcgcgcgaccagcagaacatctccagcttcgagcgcgaggaaatccgcctgcggctgcgttgcatgatcgagttgctgacccagaagctgaccgacctggagcatccgatgctgatgtccaacccggtctgcctgagccatcgcgaacgcgagatcctgcaatggaccgccgacggcaagagttccggggaaatcgccatcatcctgagcatctccgagagcacggtgaacttccaccacaagaacatccagaagaagttcgacgcgccgaacaagacgctggctgccgcctacgccgcggcgctgggtctcatcgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z