BBa_I20256 1 BBa_I20256 Promoter-RBS 2007-12-07T12:00:00Z 2015-08-31T04:07:39Z . This is part of a collection of promoter RBS pairs that are being built to complement the Measurement Kit being made in the Endy lab. false false _11_ 0 2 84 Not in stock false . false Jason Kelly component1958888 1 BBa_B0032 component1958886 1 BBa_J23116 annotation1958888 1 BBa_B0032 range1958888 1 44 56 annotation1958886 1 BBa_J23116 range1958886 1 1 35 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_J23116 1 BBa_J23116 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23116_sequence 1 ttgacagctagctcagtcctagggactatgctagc BBa_I20256_sequence 1 ttgacagctagctcagtcctagggactatgctagctactagagtcacacaggaaag BBa_B0032_sequence 1 tcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z