BBa_P1006 1 ampR ampicillin resistance cassette, reverse orientation 2006-02-03T12:00:00Z 2015-05-08T01:14:11Z This contains TetR, a terminator and then AmpR and a terminator false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1897231 1 ampicillin resistance range1897231 1 1 864 annotation1897232 1 ampR RBS range1897232 1 869 873 annotation1897233 1 ampR -10 range1897233 1 882 887 annotation1897234 1 ampR -35 range1897234 1 908 913 BBa_I51019 1 BBa_I51019 BioBrick base vector, as synthesized by Codon Devices 2008-03-22T12:00:00Z 2015-08-31T04:07:42Z [[Part:BBa_I51001|BBa_I51001]] [[Part:BBa_I51019|BBa_I51019]] is the sequence of the BioBrick base vector as synthesized by Codon Devices, Inc. in Cambridge, MA. The original design of the BioBrick base vector is available as [[Part:BBa_I51000|BBa_I51000]]. [[Part:BBa_I51001|BBa_I51001]] is the sequence of the BioBrick base vector as reported by Codon Devices, Inc. although the true sequence is something like to [[Part:BBa_I51019|BBa_I51019]]. The exact sequence of the provided DNA is difficult to determine. The corrected BioBrick base vector that was successfully constructed from [[Part:BBa_I51019|BBa_I51019]] is [[Part:BBa_I51020|BBa_I51020]]. true false _41_ 0 126 162 Discontinued false Synthesis of the BioBrick base vector design ([[Part:BBa_I51000|BBa_I51000]]) was problematic. We encountered two issues while trying to construct the base vector. First, troubleshooting efforts during synthesis compromised the design of our parts: failed attempts to clone the base vector into an ''E. coli'' strain intolerant of expression of the toxic protein CcdB led to an unnecessary redesign of the ''ccdB'' positive selection marker in the BioBrick base vector. As a result, a revised design for the BioBrick base vector ([[Part:BBa_I51001|BBa_I51001]]) was specified instead. Second, faulty part design adversely impacted the synthesis process: our pUC19-based replication origin design ([[Part:BBa_I50020|BBa_I50020]]) was similarly nonfunctional, so the revised base vector ([[Part:BBa_I51001|BBa_I51001]]) could not be propagated as specified. We eventually determined that the provided DNA for the BioBrick base vector was actually a fusion of two slightly different copies of the base vector: one with a nonfunctional version of the pUC19 origin ([[Part:BBa_I50020|BBa_I50020]]) and one with a functional version of the pUC19 origin ([[Part:BBa_I50022|BBa_I50022]]). We corrected the synthesized BioBrick base vector ([[Part:BBa_I51019|BBa_I51019]]) with molecular biology techniques to make the functional BioBrick base vector [[Part:BBa_I51020|BBa_I51020]] (see Methods). Commercial DNA synthesis processes currently rely on cloning, assembly and propagation of synthesized DNA in ''E. coli''. Difficulties during synthesis stemmed from the inclusion of both a ''ccdB'' positive selection marker that is toxic to most ''E. coli'' strains and a synthetic origin incapable of supporting plasmid replication of the BioBrick base vector. In general, for parts whose function are incompatible with growth and replication of ''E. coli'', the processes of DNA design and DNA synthesis cannot be easily decoupled. false Reshma Shetty component1961891 1 BBa_B0055 component1961873 1 BBa_G00102 component1961960 1 BBa_B0045 component1961964 1 BBa_G00100 component1961886 1 BBa_B0053 component1961937 1 BBa_B0044 component1961951 1 BBa_B0062 component1961927 1 BBa_I50020 component1961967 1 BBa_B0055 component1961949 1 BBa_G00102 component1961984 1 BBa_G00000 component1961908 1 BBa_G00000 component1961958 1 BBa_P1006 component1961953 1 BBa_B0045 component1961998 1 BBa_I50022 component1961962 1 BBa_B0053 component1961898 1 BBa_B0042 component1961875 1 BBa_B0062 component1961871 1 BBa_B0054 component1961884 1 BBa_B0045 component1961861 1 BBa_B0044 component1961988 1 BBa_P1016 component1961932 1 BBa_G00001 component1961888 1 BBa_G00100 component1961868 1 BBa_B0042 component1961974 1 BBa_B0042 component1961856 1 BBa_G00001 component1961903 1 BBa_B0043 component1961912 1 BBa_P1016 component1961979 1 BBa_B0043 component1961877 1 BBa_B0045 component1961947 1 BBa_B0054 component1961944 1 BBa_B0042 component1961882 1 BBa_P1006 annotation1961877 1 BBa_B0045 range1961877 1 177 182 annotation1961947 1 BBa_B0054 range1961947 1 2485 2553 annotation1961882 1 BBa_P1006 range1961882 1 183 1125 annotation1961861 1 BBa_B0044 range1961861 1 22 34 annotation1961944 1 BBa_B0042 range1961944 1 2473 2484 annotation1961886 1 BBa_B0053 range1961886 1 1132 1203 annotation1961912 1 BBa_P1016 range1961912 1 1349 1764 annotation1961927 1 BBa_I50020 range1961927 1 1765 2438 annotation1961949 1 BBa_G00102 range1961949 1 2554 2573 annotation1961888 1 BBa_G00100 range1961888 1 1204 1223 annotation1961984 1 BBa_G00000 range1961984 1 3765 3786 annotation1961875 1 BBa_B0062 range1961875 1 136 176 annotation1961979 1 BBa_B0043 range1961979 1 3752 3764 annotation1961937 1 BBa_B0044 range1961937 1 2460 2472 annotation1961871 1 BBa_B0054 range1961871 1 47 115 annotation1961964 1 BBa_G00100 range1961964 1 3642 3661 annotation1961868 1 BBa_B0042 range1961868 1 35 46 annotation1961951 1 BBa_B0062 range1961951 1 2574 2614 annotation1961958 1 BBa_P1006 range1961958 1 2621 3563 annotation1961856 1 BBa_G00001 range1961856 1 1 21 annotation1961998 1 BBa_I50022 range1961998 1 4203 4876 annotation1961974 1 BBa_B0042 range1961974 1 3740 3751 annotation1961903 1 BBa_B0043 range1961903 1 1314 1326 annotation1961891 1 BBa_B0055 range1961891 1 1224 1301 annotation1961967 1 BBa_B0055 range1961967 1 3662 3739 annotation1961908 1 BBa_G00000 range1961908 1 1327 1348 annotation1961932 1 BBa_G00001 range1961932 1 2439 2459 annotation1961962 1 BBa_B0053 range1961962 1 3570 3641 annotation1961873 1 BBa_G00102 range1961873 1 116 135 annotation1961953 1 BBa_B0045 range1961953 1 2615 2620 annotation1961960 1 BBa_B0045 range1961960 1 3564 3569 annotation1961884 1 BBa_B0045 range1961884 1 1126 1131 annotation1961988 1 BBa_P1016 range1961988 1 3787 4202 annotation1961898 1 BBa_B0042 range1961898 1 1302 1313 BBa_G00100 1 VF2 Forward primer for sequencing/amplifying BioBrick parts (VF2) 2004-05-24T11:00:00Z 2015-08-31T04:07:28Z Originally named VF2, primer binds upstream of the standard BBa_MCS on biobrick vectors. false false _11_1_ 0 60 7 Not in stock false false Tom Knight annotation1934505 1 VF2 range1934505 1 1 20 BBa_B0053 1 BBa_B0053 Terminator (His) 2004-01-29T12:00:00Z 2015-08-31T04:07:20Z Terminator from the E.coli His operon false true _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation318602 1 stem_loop range318602 1 9 43 BBa_I50020 1 pUC19 ori Minimal pUC19-derived high copy replication origin 2006-01-09T12:00:00Z 2015-08-31T04:07:41Z High copy origin of replication derived from pSB1A3. Designed to omit antibiotic resistance markers and primer binding sites. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1910691 1 C to T, nonfunctional mutation range1910691 1 467 467 annotation1793680 1 origin of replication range1793680 1 27 615 annotation1910688 1 G to A, nonfunctional mutation range1910688 1 265 265 annotation1793683 1 RNAI transcript promoter -10 range1793683 1 182 187 annotation1910690 1 C to T, nonfunctional mutation range1910690 1 303 303 annotation1793682 1 RNAI transcript promoter -35 range1793682 1 204 209 annotation1793681 1 RNAII transcript range1793681 1 63 615 annotation1782181 1 ORI range1782181 1 615 615 annotation1910689 1 G to A, nonfunctional mutation range1910689 1 274 274 annotation1793684 1 RNAI transcript range1793684 1 66 173 annotation1910687 1 G to A, nonfunctional mutation range1910687 1 261 261 annotation1793685 1 RNAII transcript promoter -10 sequence range1793685 1 48 53 annotation1793686 1 RNAII transcript promoter -35 sequence range1793686 1 27 32 annotation1782180 1 rep (pMB1) range1782180 1 16 630 BBa_B0055 1 BBa_B0055 -- No description -- 2005-11-16T12:00:00Z 2015-08-31T04:07:20Z Terminator to be placed upstream of multiple cloning site in new pSB series plasmids. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1783311 1 identical to bacteriophage T3 range1783311 1 28 66 annotation1783301 1 stem loop from bacteriophage T3 range1783301 1 36 57 BBa_B0044 1 TOPO Topoisomerase I mediated cloning site (reverse) 2006-02-04T12:00:00Z 2015-08-31T04:07:20Z Insertion of this site will enable generation of a TOPO vector. The vector will have a T overhang and permit binding of topoisomerase I for direct cloning of PCR products. See http://openwetware.org/wiki/Topoisomerase_I_mediated_TA_cloning for a complete description of Topoisomerase I mediated cloning. This site belongs 3' of the cloning site. It is the reverse complement of BBa_B0043. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1797129 1 Generated T overhang range1797129 1 9 9 annotation1797127 1 Arbitrary sequence (could be any bases) range1797127 1 6 8 annotation1797128 1 Topoisomerase I recognition site range1797128 1 9 13 annotation1797126 1 Nt.BstNB I recognition site range1797126 1 1 5 BBa_B0054 1 BBa_B0054 Transcriptional terminator 2005-11-16T12:00:00Z 2015-08-31T04:07:20Z Terminator to be placed downstream of multiple cloning site in new pSB series plasmids. Similar to BBa_B0051. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1783342 1 identical to E. coli MG1655 between tonB and yciA range1783342 1 4 43 annotation1747359 1 stem loop range1747359 1 11 42 BBa_G00102 1 VR Reverse BioBrick primer annealing site (VR binding site) 2006-02-03T12:00:00Z 2015-08-31T04:07:28Z This is the VR sequence to be used in construction of plasmids which include the VR primer site. It is the reverse complement of BBa_G00101. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1961229 1 VR range1961229 1 1 20 BBa_P1016 1 ccdB ccdB cassette without ccdA- 2007-01-29T12:00:00Z 2015-06-15T01:13:47Z This part is derived from BBa_P1010 but it lacks ccdA-. This part is a differs from BBa_P1011 in that the mutations introduced in BBa_P1011 to remove restriction sites are not present in this part. It does have the "normal" ccd promoter and ccdB coding region. It also has a double TAA stop codon as per BioBrick conventions. true false _41_ 4206 126 70 Not in stock false ccdA- was eliminated since it is an inactive form of ccdA and should not be required for the toxic phenotype of ccdB. false Reshma Shetty annotation1910685 1 -10 range1910685 1 64 69 annotation1910684 1 -35 range1910684 1 41 46 annotation1910686 1 ccdB range1910686 1 108 416 BBa_G00001 1 Suffix BioBrick cloning site suffix 2006-03-13T12:00:00Z 2015-08-31T04:07:27Z This part is the standard BioBricks suffix. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1934226 1 SpeI range1934226 1 2 7 annotation1934227 1 PstI range1934227 1 16 21 annotation1821544 1 Suffix range1821544 1 1 21 annotation1934228 1 NotI range1934228 1 9 16 BBa_I50022 1 pUC19 ori Minimal pUC19-derived high copy replication origin 2008-01-05T12:00:00Z 2015-08-31T04:07:42Z pSB1A3 High copy origin of replication derived from pSB1A3. Designed to omit antibiotic resistance markers and primer binding sites. Lacks mutations that render BBa_I50020 nonfunctional as a replication origin. false false _41_ 0 126 162 Not in stock false We had to leave several restriction sites in because point mutations that eliminated these sites were found to render the origin nonfunctional. false Reshma Shetty annotation1959117 1 rep (pMB1) range1959117 1 16 630 annotation1959123 1 RNAI transcript promoter -10 range1959123 1 182 187 annotation1959125 1 ORI range1959125 1 615 615 annotation1959124 1 RNAI transcript promoter -35 range1959124 1 204 209 annotation1959121 1 RNAII transcript range1959121 1 63 615 annotation1959120 1 RNAII transcript promoter -10 sequence range1959120 1 48 53 annotation1959122 1 RNAI transcript range1959122 1 66 173 annotation1959119 1 origin of replication range1959119 1 27 615 annotation1959118 1 RNAII transcript promoter -35 sequence range1959118 1 27 32 BBa_B0045 1 NheI NheI restriction enzyme site (XbaI, SpeI compatible overhang) 2006-03-13T12:00:00Z 2015-08-31T04:07:20Z NheI recognition site. Digestion with NheI generates a compatible cohesive end to XbaI and SpeI. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1822724 1 NheI site range1822724 1 1 6 BBa_B0043 1 TOPO Topoisomerase I mediated cloning site (forward) 2006-02-04T12:00:00Z 2015-08-31T04:07:20Z Insertion of this site will enable generation of a TOPO vector. The vector will have a T overhang and permit binding of topoisomerase I for direct cloning of PCR products. See http://openwetware.org/wiki/Topoisomerase_I_mediated_TA_cloning for a complete description of Topoisomerase I mediated cloning. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1797104 1 Generated T overhang range1797104 1 5 5 annotation1797102 1 Nt.BstNB I recognition site range1797102 1 9 13 annotation1797101 1 Topoisomerase I recognition site range1797101 1 1 5 annotation1797103 1 Arbitrary sequence (could be any bases) range1797103 1 6 8 BBa_B0062 1 BBa_B0062 Terminator (Reverse B0052) 2004-01-29T12:00:00Z 2015-08-31T04:07:21Z Reverse of B0052, E.coli transcriptional terminator from the ribosomal RNA rrnC operon. false false _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation318637 1 stem_loop range318637 1 14 33 BBa_G00000 1 Prefix BioBrick cloning site prefix 2006-03-13T12:00:00Z 2015-08-31T04:07:27Z This part is the standard BioBricks prefix. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1961228 1 NotI site range1961228 1 7 14 annotation1934225 1 Prefix range1934225 1 1 22 annotation1934223 1 EcoRI site range1934223 1 1 6 annotation1934224 1 XbaI site range1934224 1 16 21 BBa_B0042 1 TSS Translational stop sequence 2006-02-04T12:00:00Z 2015-08-31T04:07:20Z This part contains a stop codon in all 6 reading frames. Useful for ensuring that translation does not proceed through this part. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1797088 1 stop codon (-3 frame) range1797088 1 5 7 annotation1797085 1 stop codon (+3 frame) range1797085 1 6 8 annotation1797083 1 stop codon (+2 frame) range1797083 1 2 4 annotation1797084 1 stop codon (-1 frame) range1797084 1 1 3 annotation1797087 1 stop codon (-2 frame) range1797087 1 9 11 annotation1797086 1 stop codon (+1 frame) range1797086 1 10 12 BBa_I50022_sequence 1 cccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat BBa_I51019_sequence 1 tactagtagcggccgctgcaggagtcactaagggttagttagttagattagcagaaagtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattggggctcactcaaaggcggtaatcagataaaaaaaatccttagctttcgctaaggatgatttctgctagcttattaccaatgcttaatcagggaggcacctatctcagcgatctggcgattacgttcgtccatagttgcctggctccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagggctgcaataataccgcgggacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagcgagagtaagaagttcgccagttaagagtttgcgcaacgttgttgccatagctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcacccatgttgtgcaaaaaagcggtaagctccttcggtcctccgatcgttgtcagaagtaagttggccgccgtgttatcactcatggttatggcagcgctgcataattcgcgtactgtcatgccgtccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacagagcagaactttaaaagtgctcatcattgggaaacgttcttcggggcgaaaactctcaagaatcttaccgctgttgaggtccagttcgatgtaacccacacgtgcacccaactgatcttcggcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatattcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatagatatttgaatgtatttaggctagctccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtttgccacctgacgtctaagaaaaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgagttgattgctacgtaattagttagttagcccttagtgactcgaattcgcggccgcttctagagggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataacccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtagctactgccagtagcgataagtcgtgtcttaccgggttggattcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatctggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacattactagtagcggccgctgcaggagtcactaagggttagttagttagattagcagaaagtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattggggctcactcaaaggcggtaatcagataaaaaaaatccttagctttcgctaaggatgatttctgctagcttattaccaatgcttaatcagggaggcacctatctcagcgatctggcgattacgttcgtccatagttgcctggctccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagggctgcaataataccgcgggacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagcgagagtaagaagttcgccagttaagagtttgcgcaacgttgttgccatagctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcacccatgttgtgcaaaaaagcggtaagctccttcggtcctccgatcgttgtcagaagtaagttggccgccgtgttatcactcatggttatggcagcgctgcataattcgcgtactgtcatgccgtccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacagagcagaactttaaaagtgctcatcattgggaaacgttcttcggggcgaaaactctcaagaatcttaccgctgttgaggtccagttcgatgtaacccacacgtgcacccaactgatcttcggcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatattcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatagatatttgaatgtatttaggctagctccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtttgccacctgacgtctaagaaaaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgagttgattgctacgtaattagttagttagcccttagtgactcgaattcgcggccgcttctagagggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataacccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat BBa_I50020_sequence 1 cccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtagctactgccagtagcgataagtcgtgtcttaccgggttggattcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatctggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat BBa_B0045_sequence 1 gctagc BBa_B0062_sequence 1 cagataaaaaaaatccttagctttcgctaaggatgatttct BBa_P1016_sequence 1 ggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataa BBa_B0055_sequence 1 aaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgagttgattgctacgtaa BBa_B0044_sequence 1 gagtcactaaggg BBa_B0042_sequence 1 ttagttagttag BBa_B0054_sequence 1 attagcagaaagtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattggg BBa_G00000_sequence 1 gaattcgcggccgcttctagag BBa_G00001_sequence 1 tactagtagcggccgctgcag BBa_B0053_sequence 1 tccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtt BBa_G00100_sequence 1 tgccacctgacgtctaagaa BBa_P1006_sequence 1 ttattaccaatgcttaatcagggaggcacctatctcagcgatctggcgattacgttcgtccatagttgcctggctccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagggctgcaataataccgcgggacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagcgagagtaagaagttcgccagttaagagtttgcgcaacgttgttgccatagctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcacccatgttgtgcaaaaaagcggtaagctccttcggtcctccgatcgttgtcagaagtaagttggccgccgtgttatcactcatggttatggcagcgctgcataattcgcgtactgtcatgccgtccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacagagcagaactttaaaagtgctcatcattgggaaacgttcttcggggcgaaaactctcaagaatcttaccgctgttgaggtccagttcgatgtaacccacacgtgcacccaactgatcttcggcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatattcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatagatatttgaatgtatttag BBa_G00102_sequence 1 gctcactcaaaggcggtaat BBa_B0043_sequence 1 cccttagtgactc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z