BBa_I52002 1 BBa_I52002 ccdB and minimal pUC19 derived high copy origin 2008-01-05T12:00:00Z 2015-08-31T04:07:42Z ccdB and pUC19 {| |- |width='35%'| [[Image:CcdB_Plasmid.png]] |width='65%'| The CcdB protein, constitutively expressed by P1016, is lethal to most of the [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=cell BioBrick cell strains], only [[Part:BBa_V1005|DB3.1]] is resistant. |} This part is designed to be located in the multiple cloning site of low copy BioBrick vectors. It is composed of two parts [[Part:BBa_P1016|BBa_P1016]] and [[Part:BBa_I50022|BBa_I50022]]. [[Part:BBa_P1016|BBa_P1016]] provides selection against non-insert containing clones (see below). [[Part:BBa_I50022|BBa_I50022]] is based on the high copy pUC19 origin. It enables the base vector to be propagated at high copy for ease of purification. P1016 is used when putting BioBrick parts into BioBrick plasmids. The part to be inserted and the plasmid are cut with BioBrick enzymes and mixed. The mixture will include both the original uncut or religated plasmid and the desired structure. However, because of CcdB, all of the cells containing the original plasmid die and the surviving colonies are the desired result. I50020 is useful because it is a high copy origin located within the BioBricks cloning site. Any plasmids containing this part will be propagated (and thus purified) at high copy. Once the insert of interest is cloned into the plasmid, the I50022 part is eliminated and the plasmid returns to the copy number of the primary origin in the plasmid (usually low copy). A new set of low copy BioBrick [[Help:Plasmids|plasmids]] are available with the I52001 insert. See [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=I52001 I52001 Physical DNA] for the current list of plasmids that are available in this form.<br> true false _41_ 0 126 162 Discontinued false This part is a composite part of BBa_P1016 and BBa_I50022. It is designed to be placed in the multiple cloning site of BioBricks vectors. Vectors with this part in the multiple cloning site will be selected against during BioBricks assembly because BBa_P1016 is lethal to most cell strains. Also, BBa_I50022 enables the vector to be propagated at high copy regardless of the other origins on the vector. true Reshma Shetty component1959139 1 BBa_I50022 component1959129 1 BBa_P1016 annotation1959129 1 BBa_P1016 range1959129 1 1 416 annotation1959139 1 BBa_I50022 range1959139 1 417 1090 BBa_I50022 1 pUC19 ori Minimal pUC19-derived high copy replication origin 2008-01-05T12:00:00Z 2015-08-31T04:07:42Z pSB1A3 High copy origin of replication derived from pSB1A3. Designed to omit antibiotic resistance markers and primer binding sites. Lacks mutations that render BBa_I50020 nonfunctional as a replication origin. false false _41_ 0 126 162 Not in stock false We had to leave several restriction sites in because point mutations that eliminated these sites were found to render the origin nonfunctional. false Reshma Shetty annotation1959117 1 rep (pMB1) range1959117 1 16 630 annotation1959119 1 origin of replication range1959119 1 27 615 annotation1959125 1 ORI range1959125 1 615 615 annotation1959118 1 RNAII transcript promoter -35 sequence range1959118 1 27 32 annotation1959122 1 RNAI transcript range1959122 1 66 173 annotation1959123 1 RNAI transcript promoter -10 range1959123 1 182 187 annotation1959121 1 RNAII transcript range1959121 1 63 615 annotation1959124 1 RNAI transcript promoter -35 range1959124 1 204 209 annotation1959120 1 RNAII transcript promoter -10 sequence range1959120 1 48 53 BBa_P1016 1 ccdB ccdB cassette without ccdA- 2007-01-29T12:00:00Z 2015-06-15T01:13:47Z This part is derived from BBa_P1010 but it lacks ccdA-. This part is a differs from BBa_P1011 in that the mutations introduced in BBa_P1011 to remove restriction sites are not present in this part. It does have the "normal" ccd promoter and ccdB coding region. It also has a double TAA stop codon as per BioBrick conventions. true false _41_ 4206 126 70 Not in stock false ccdA- was eliminated since it is an inactive form of ccdA and should not be required for the toxic phenotype of ccdB. false Reshma Shetty annotation1910685 1 -10 range1910685 1 64 69 annotation1910684 1 -35 range1910684 1 41 46 annotation1910686 1 ccdB range1910686 1 108 416 BBa_I50022_sequence 1 cccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat BBa_I52002_sequence 1 ggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataacccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat BBa_P1016_sequence 1 ggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z