BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_E0030 1 eyfp enhanced yellow fluorescent protein derived from A. victoria GFP 2004-03-02T12:00:00Z 2015-08-31T04:07:25Z Modificaitons to Clontech EYFP by Reshma Shetty Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false true Caitlin Conboy and Jennifer Braff BBa_R1050 1 cI HK022 Promoter, Standard (HK022 cI regulated) <br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z Bacteriophage HK022. Released HQ 2013 [Note: This is the same part as R0050 except that the -10 and -35 sites and spacing have been changed to comply with BBa_S0001].<br><br> The pR regulatory region is a 98 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two operator sites at which HK022 cI protein can bind cooperatively. The -35 and -10 regions from pR are included along with some flanking sequences. The cutoff for the 5' end of the regulatory region was placed just after the pM -10 region which promotes transcription of a gene upstream (thus the pM -10 region is not included). The cutoff for the 3' end of the regulatory region was placed immediately prior to the RBS. </p> false false _1_ 0 24 7 In stock false <P> <P>Derived from <genbank>STHK022N</genbank>.<br> Modified to comply with BBa_S0001:<br> TTGACA-17N-GATACT<br><P> Literature claims that there is no cross-talk between HK022 cI regulatory region, Lambda cI, 434 cI and P22 cI, but this has not been verified experimentally by the synthetic biology group at MIT. true Reshma Shetty, Drew Endy annotation7073 1 BBa_R1050 range7073 1 1 56 annotation2070 1 putative range2070 1 44 44 annotation2071 1 -10 range2071 1 31 36 annotation2067 1 OR1 range2067 1 38 52 annotation2065 1 -35 range2065 1 8 14 annotation2066 1 OR2 range2066 1 14 28 BBa_I6048 1 BBa_I6048 Promoter O_H Test R1050.E0430 2004-03-16T12:00:00Z 2015-08-31T04:07:43Z -- No description -- false false _1_ 0 24 7 It's complicated false false Caitlin Conboy and Jennifer Braff component948664 1 BBa_B0010 component948647 1 BBa_R1050 component948659 1 BBa_E0030 component948657 1 BBa_B0034 component948674 1 BBa_B0012 annotation948659 1 BBa_E0030 range948659 1 83 805 annotation948657 1 BBa_B0034 range948657 1 65 76 annotation948647 1 BBa_R1050 range948647 1 1 56 annotation948674 1 BBa_B0012 range948674 1 902 942 annotation948664 1 BBa_B0010 range948664 1 814 893 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R1050_sequence 1 ttaggtattgacatgtactatcagttccgtgatactatgaaccataagttcaccac BBa_B0034_sequence 1 aaagaggagaaa BBa_E0030_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I6048_sequence 1 ttaggtattgacatgtactatcagttccgtgatactatgaaccataagttcaccactactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z