BBa_I712667 1 HIV-1 HIV-1 aspartyl protease 2007-10-23T11:00:00Z 2015-08-31T04:07:47Z HIV HIV-1 protease is an aspartyl protease that is essential for the life-cycle of HIV and cleaves proteins at specific aminoacid sequence. false false _130_ 0 2367 9 In stock false true Rok Gaber annotation1953712 1 START range1953712 1 1 3 annotation1953713 1 STOP range1953713 1 301 303 annotation1953711 1 HIV protease range1953711 1 1 303 BBa_I712667_sequence 1 atgcctcagatcactctttggcagcgacccctcgtcacaataaagataggggggcaattaaaggaagctctattagatacaggagcagatgatacagtattagaagaaatgaatttgccaggaagatggaaaccaaaaatgatagggggaattggaggttttatcaaagtaagacagtatgatcagatactcatagaaatctgcggacataaagctataggtacagtattagtaggacctacacctgtcaacataattggaagaaatctgttgactcagattggctgcactttaaatttttag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z