BBa_I714036 1 BBa_I714036 Riboregulator key 1 2007-10-24T11:00:00Z 2015-08-31T04:07:47Z J01008 Released HQ 2013 The same as J01008 false false _142_ 0 1911 9 In stock false The Isaacs key1 riboregulator taR12 is modeled on the hok/sok post-segregational killing method of plasmid R1. It makes 25 base pairs with its counterpart, the riboregulator J01010 (aka "lock 1" or "crR12"). Isaacs documentation (see reference #1): Upon induction of the araC promoter (using 0.25% arabinose solution), the taR12 key activated the corresponding crR12 lock to express the downstream indicator, GFP, to levels of fluorescence 19-fold greater than without taR12 expression. Maximal expression was reached at 70 minutes after addition of arabinose solution, and was maintained after that point. false Chunbo Lou BBa_I714036_sequence 1 acccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z