BBa_I718018 1 BBa_I718018 dapAp promoter 2007-10-25T11:00:00Z 2015-08-31T04:07:53Z none yet dapAp is the promter of dapA gene in E.coli. DapA enzyme is part of diaminopimelate (DAP)biosynthesis pathway. DAP is necessary for peptidoglycan and lysine biosynthesis. dapAp prmoter has been previously studied: Acord04: Acord J, Masters M (2004). "Expression from the Escherichia coli dapA promoter is regulated by intracellular levels of diaminopimelic acid." FEMS Microbiol Lett 235(1);131-7. PMID: 15158272 It has been shown that dapAp driven expression is inhibited at hight DAP. We have tried to confirm this by false false _141_ 0 1568 9 In stock false None false Eimad Shotar BBa_I718018_sequence 1 aacaatcagaacggttctgtctgcttgcttttaatgccataccaaacgtaccattgagacacttgtttgcacagaggatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z