BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0021 1 BBa_B0021 LuxICDABEG (+/-), reversed 2003-10-13T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Bidirectional transcriptional terminator cloned in the reverse direction of B0011. 22 bp stem-loop false true _1_ 0 24 7 In stock false Cloned with primer-dimers into pSB1A2 true Caitlin Conboy annotation7024 1 BBa_B0021 range7024 1 1 46 BBa_J45002 1 BAMT SAM:benzoic acid carboxyl methyltransferase; converts benzoic acid to methyl benzoate (floral odor) 2006-06-06T11:00:00Z 2015-08-31T04:08:49Z Genbank accession number(s): AF198492 This part is from A. majus. BAMT catalyzes the transfer of a methyl group from SAM (S-adenosyl methyltransferase) to benzoic acid, creating methyl benzoate. Methyl benzoate produces a "pleasant" smell. false false _84_ 0 977 84 It's complicated true none as of yet false Andr?? Green II annotation1880475 1 putative start codon 1 range1880475 1 1 3 annotation1880476 1 putative start codon 2 range1880476 1 10 12 annotation1880495 1 double TAA stop codon range1880495 1 1093 1098 annotation1880494 1 BAMT range1880494 1 1 1095 annotation1880506 1 A -> G to eliminate SpeI site range1880506 1 702 702 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_I723125 1 BBa_I723125 Test reporter again 2007-07-30T11:00:00Z 2015-08-31T04:07:54Z From my head again Long desc true false _126_ 0 2129 9 Discontinued false design considerations false Maciej Trybilo component1940411 1 BBa_J45002 component1940412 1 BBa_B0012 component1940404 1 BBa_B0032 component1940418 1 BBa_B0021 component1940416 1 BBa_B0011 annotation1940416 1 BBa_B0011 range1940416 1 1175 1220 annotation1940404 1 BBa_B0032 range1940404 1 1 13 annotation1940418 1 BBa_B0021 range1940418 1 1229 1274 annotation1940411 1 BBa_J45002 range1940411 1 20 1117 annotation1940412 1 BBa_B0012 range1940412 1 1126 1166 BBa_I723125_sequence 1 tcacacaggaaagtactagatgaaagtgatgaagaaacttttgtgtatgaatattgcaggagatggtgaaactagctacgccaacaattctggccttcaaaaagttatgatgtcaaaatcattgcatgttttagacgaaacccttaaagatattatcggtgatcatgttggcttcccaaaatgcttcaagatgatggatatgggttgttcatcagggcctaacgcccttttggtcatgtccggcattataaatacaattgaggatttgtacacagagaagaatattaatgaattacctgaatttgaggtttttctgaacgatcttccagacaacgacttcaacaacctcttcaaattgttatcacatgagaatggaaactgctttgtatatggtttgcctggatctttctacgggagactattgccaaaaaagagcctacactttgcttattcttcctacagtattcactggctctctcaggttcctgaagggctggaggataataacagacaaaacatttacatggcaacggaaagtcctccggaagtgtacaaagcatacgcaaagcaatacgaaagagacttctccacatttctaaagttgcgaggcgaggaaattgtaccaggtggacgcatggtcttgacatttaacggcagaagtgttgaagatccctcgagcaaagatgacttagcaattttcacattgcttgcaaaaacactggttgatatggtggctgaggggcttgtcaagatggacgatttgtactcgtttaacattcctatttactcaccatgtacgcgcgaagtagaggcagcaattctgagtgaagggtcttttacgttggacaggctagaggtctttcgtgtttgttgggatgcaagtgactacacagatgacgatgatcagcaagacccatcaatctttggcaaacaaaggagtggaaaatttgtggcagattgtgtacgggctattacggaaccaatgctggctagccattttgggagcactattatggatcttctatttggaaagtatgcaaagaaaatagtggagcatctatctgtggagaactcgtcatatttcagcatagtagtttctctaagtaggagataataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagaaataataaaaaagccggattaataatctggctttttatattctct BBa_B0021_sequence 1 aaataataaaaaagccggattaataatctggctttttatattctct BBa_J45002_sequence 1 atgaaagtgatgaagaaacttttgtgtatgaatattgcaggagatggtgaaactagctacgccaacaattctggccttcaaaaagttatgatgtcaaaatcattgcatgttttagacgaaacccttaaagatattatcggtgatcatgttggcttcccaaaatgcttcaagatgatggatatgggttgttcatcagggcctaacgcccttttggtcatgtccggcattataaatacaattgaggatttgtacacagagaagaatattaatgaattacctgaatttgaggtttttctgaacgatcttccagacaacgacttcaacaacctcttcaaattgttatcacatgagaatggaaactgctttgtatatggtttgcctggatctttctacgggagactattgccaaaaaagagcctacactttgcttattcttcctacagtattcactggctctctcaggttcctgaagggctggaggataataacagacaaaacatttacatggcaacggaaagtcctccggaagtgtacaaagcatacgcaaagcaatacgaaagagacttctccacatttctaaagttgcgaggcgaggaaattgtaccaggtggacgcatggtcttgacatttaacggcagaagtgttgaagatccctcgagcaaagatgacttagcaattttcacattgcttgcaaaaacactggttgatatggtggctgaggggcttgtcaagatggacgatttgtactcgtttaacattcctatttactcaccatgtacgcgcgaagtagaggcagcaattctgagtgaagggtcttttacgttggacaggctagaggtctttcgtgtttgttgggatgcaagtgactacacagatgacgatgatcagcaagacccatcaatctttggcaaacaaaggagtggaaaatttgtggcagattgtgtacgggctattacggaaccaatgctggctagccattttgggagcactattatggatcttctatttggaaagtatgcaaagaaaatagtggagcatctatctgtggagaactcgtcatatttcagcatagtagtttctctaagtaggagataataa BBa_B0032_sequence 1 tcacacaggaaag BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z