BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I739101 1 BBa_I739101 Double Promoter (constitutive / TetR, negative) 2007-10-11T11:00:00Z 2015-08-31T04:08:01Z Synthetic DNA sdfasdf false false _124_ 0 2183 62 Not in stock false asdf false Stefan Luzi annotation1946101 1 TetR 1 range1946101 1 64 83 annotation1946100 1 J23100 range1946100 1 1 35 annotation1946102 1 TetR 1 range1946102 1 44 63 annotation1946257 1 R0040 (2x TetR 1) range1946257 1 44 83 annotation1946099 1 Scar range1946099 1 36 43 BBa_I739014 1 BBa_I739014 Single regulated intermediate for P22 cII +LVA (I739101.B0034.C0053) 2007-10-13T11:00:00Z 2015-08-31T04:08:01Z dsf sdf false false _124_ 0 2183 62 Not in stock false df false Stefan Luzi component2245691 1 BBa_C0053 component2245687 1 BBa_I739101 component2245689 1 BBa_B0034 annotation2245689 1 BBa_B0034 range2245689 1 92 103 annotation2245687 1 BBa_I739101 range2245687 1 1 83 annotation2245691 1 BBa_C0053 range2245691 1 110 796 BBa_C0053 1 c2 P22 c2 repressor from Salmonella phage P22 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage P22 Released HQ 2013 The P22 c2 repressor protein coding sequence is a 720 base-pair sequence with the standard RBS-compatible BioBrick prefix and the standard BioBrick suffix sections on its ends. It binds to the P22 c2 regulatory sequence, BBa_R0053. The sequence contains a LVA tag for faster degredation.</p> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P> References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P><P> true Maia Mahoney annotation2213993 1 Help:Barcodes range2213993 1 688 712 annotation1751 1 stop range1751 1 682 687 annotation1750 1 LVA range1750 1 649 681 annotation1747 1 cII p22 range1747 1 1 648 annotation7036 1 BBa_C0053 range7036 1 1 687 BBa_B0034_sequence 1 aaagaggagaaa BBa_I739101_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagtccctatcagtgatagagattccctatcagtgatagagat BBa_I739014_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagtccctatcagtgatagagattccctatcagtgatagagattactagagaaagaggagaaatactagatgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_C0053_sequence 1 atgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z