BBa_I742126 1 revPlam Reverse lambda cI-regulated promoter 2007-10-21T11:00:00Z 2015-08-31T04:08:02Z See BBa_R0051. This is an exact 'upside down' version of BBa_R0051. The promoter has two DNA binding sites for lambda cI repressor BBa_C0051. By adding this part, we wish to emphasise the possibility of engineering both DNA strands, and the additional regulatory potential that it gives. false false _123_ 0 1968 9 Not in stock false Any 'upside down' (reverse complementary) sequences made by PCR amplification need be made with suffix and prefix is opposite order with respect to the original default sequence. false Caroline Dahl BBa_I742126_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgtta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z