BBa_I745010 1 Gata3-5 Gata3-5 2007-10-25T11:00:00Z 2015-08-31T04:08:04Z Princeton iGEM2007 team. A short RNA targeted to the 5' region of Gata3. false false _145_ 0 681 74 Not in stock false Used extensive bioinformatics to determine optimal sequence. false Princeton iGEM2007 BBa_I745010_sequence 1 gctcagcgacttctccaagac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z