BBa_I746917 1 BBa_I746917 P7 GFP 2008-09-29T11:00:00Z 2015-08-31T04:08:05Z P7 GFP was created and described by: Fisher et al(2008): "Laboratory evolution of fast-folding green fluorescent protein using secretory pathway quality control", PLoS ONE 3(6) It was biobricked by PCR and standard assembly from DNA kindly provided by Dr Adam C Fisher, Cornell University, New York. Coding region of P7 GFP (Fisher et al(2008): "Laboratory evolution of fast-folding green fluorescent protein using secretory pathway quality control", PLoS ONE 3(6)) P7 GFP carries the following amino acid changes as compared to mut3, the "standard" GFP used in the majority of registry constructs: F64L, G65A, V68L, N105Y, E124V, Y145F Its in vivo properties are the same as those of mut3 GFP (for improved in vivo properties see superfolder GFP: I746916). However, it is more stable in vitro and resists denaturation better than mut3. Additionally it refolds (after denaturation) at a much faster rate than does mut3 GFP - hence it might be useful for in vitro applications. It has been used in the following constructs: Driven by pBAD and T7 promoters: I746904 and I746906 respectively. A 6-his tagged version for purification exists and is driven by pBAD or T7 as well: I746905 and I746907 are the respective part numbers. false false _116_ 0 2122 9 Not in stock false PCR was carried out from plasmid DNA followed by standard assembly into several constructs. false Stefan Milde annotation1977538 1 P7 GFP coding sequence range1977538 1 1 720 annotation1977536 1 start range1977536 1 1 3 annotation1977537 1 stop range1977537 1 715 720 BBa_I746917_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgacgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactctcgcgtatggtcttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggtactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgtgttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactttaactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctggaattacacatggcatggatgaactatacaaatgatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z