BBa_I749000 1 BBa_I749000 bchB reverse primer 2007-10-25T11:00:00Z 2015-08-31T04:08:05Z pHM6 24 base pair bchB reverse primer for the subunit of light independant protochlorophyllide reductase. false false _109_ 0 969 73 Not in stock false designed usig EcorI/BamHI false Laina Magaya BBa_I749000_sequence 1 ttaggatccccgttcgccttggtttgacttact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z