BBa_I751501 1 BBa_I751501 plux-cI hybrid promoter 2007-10-24T11:00:00Z 2015-08-31T04:08:06Z sense TWO INPUTS, activation by AHL and repression by LacI. false false _151_ 0 2188 9 Not in stock false Based on the AHL regulated BioBrick part R0062 and the previous work on LacI regulated promoter (ref. 1), we designed a new promoter regulated by AHL and LacI. Since this promoter is a kind of a "HYBRID" of the two, we call it HYBRID PROMOTER. Compared with existing BioBrick hybrid promoter R0065, this promoter is different in that its sequence is much shorter with lux box and -35 region overlapping, and that it is repressed by LacI, not cI. Also, the output is clearly detected as shown in Fig. 3. false Kenichiro Iwasaki annotation1955481 1 OR2 range1955481 1 26 41 annotation1955478 1 plux-cI hybrid promoter range1955478 1 19 66 annotation1955482 1 luxR binding range1955482 1 1 18 annotation1955480 1 -10 range1955480 1 42 47 annotation1955477 1 OR1 range1955477 1 48 66 annotation1955479 1 -35 range1955479 1 19 25 BBa_I751501_sequence 1 acctgtaggatcgtacaggtttacgtaacaccgtgcgtgttgatgcttttatcaccgccagtggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z