BBa_I751502 1 BBa_I751502 plux-lac hybrid promoter 2007-10-24T11:00:00Z 2015-08-31T04:08:06Z sense TWO INPUTS, activation by AHL and repression by LacI. false false _151_ 0 2188 9 Not in stock false Compared with existing BioBrick hybrid promoter R0065, this promoter is different in that its sequence is much shorter with lux box and -35 region overlapping, and that it is repressed by LacI, not cI. Also, the output is clearly detected as shown in Fig. 3. false Kenichiro Iwasaki annotation1955560 1 -35 range1955560 1 20 26 annotation1955563 1 O1 range1955563 1 49 74 annotation1955559 1 plac range1955559 1 20 74 annotation1955564 1 luxR binding site range1955564 1 1 19 annotation1955562 1 O1 range1955562 1 27 41 annotation1955561 1 -10 range1955561 1 42 48 BBa_I751502_sequence 1 acctgtaggatcgtacaggtttacttgtgagcggataacaatatagtgtgtggaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z