BBa_I765001 1 pUV UV promoter 2007-10-25T11:00:00Z 2015-08-31T04:08:09Z Genomic sequence This device is regulated by UV irradiation false false _118_ 0 2266 9 In stock false None true iGEM Colombian Team 2007 annotation1955941 1 promoter range1955941 1 1 76 BBa_I765001_sequence 1 ggcaggaagaccgggcgcatgagcgtattttgtttatctaatatgcctgaaagcgcataccgctatggagggggtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z