BBa_I766103 1 BBa_I766103 RR Leucine Zipper 2007-08-08T11:00:00Z 2015-08-31T04:08:09Z tbd. Binds with complementary zipper EE, can be used to create binding interactions between desired elements through zipper paired to appropriate gene. false false _155_ 0 2019 9 Not in stock false Non-BioBrick. Cloned using primers containing adaptor regions for combinatorial cloning using Type IIS restriction enzymes. false Jimmy Jie Min Huang BBa_I766103_sequence 1 ggtagcgatggttctggttctggttctggttctctggaaatccgtgcggcgttcctggaaaaagaaaacaccgcgctgcgtacccgtgcggcggaactgcgtaaacgtgttggtcgttgccgtaacatcgtttctaaatacgaaacccgttacggtccgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z