BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J07039 1 BBa_J07039 Threshold: Activation module (cI antisense with hairpins) 2005-07-21T11:00:00Z 2015-08-31T04:08:20Z Part of the thresholding device (works with j07036 and j07037). This encodes the antisense mRNA to the cI transcript (j07036), and hence regulates cI in the cell and thereby indirectly controls the level of expression of reporter gene (j07037). This part encodes antisense mRNA of j07036 along with hairpin loops on the edges to keep it linear. false false _21_ 0 379 21 Not in stock false false Yaser (Ray) Khan component1590690 1 BBa_R0011 component1590706 1 BBa_I1032 component1590724 1 BBa_B0012 component1590714 1 BBa_B0010 annotation1590706 1 BBa_I1032 range1590706 1 64 318 annotation1590690 1 BBa_R0011 range1590690 1 1 54 annotation1590724 1 BBa_B0012 range1590724 1 415 455 annotation1590714 1 BBa_B0010 range1590714 1 327 406 BBa_I1032 1 BBa_I1032 CI(1) &quot;micRNA&quot; asRNA 2003-01-31T12:00:00Z 2015-08-31T04:07:29Z see references Region which serves as basis for transcription of asRNA that binds to and inhibits <bb_part>BBa_I1030</bb_part>'s mRNA transcript. Has LacO-1 regulatory region and a Promoter. Part of the XOR gate comprised of <bb_part>BBa_I1030</bb_part> and <bb_part>BBa_I1040</bb_part>, their corresponding asRNA coding sequences (<bb_part>BBa_I1012</bb_part> and <bb_part>BBa_I1032</bb_part>). false false _1_ 0 24 7 It's complicated false <P> <P>Complementary to beginning of <bb_part>BBa_I1030</bb_part> transcript covering junk region, RBS, start codon, and 73 bp into coding sequence. Two stem loops flank the antisense region. [<A href="http://biobricks.ai.mit.edu/BB_References.htm#KEIL96">KEIL96</A>] <P> Incompatible with systems containing <bb_part>BBa_I1031</bb_part> <br>Compatible with <bb_part>BBa_I1020</bb_part>, <bb_part>BBa_I1021</bb_part>, <bb_part>BBa_I1022</bb_part>, <bb_part>BBa_I1023</bb_part>. true Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation7052 1 BBa_I1032 range7052 1 1 255 annotation1891 1 LacO-1 range1891 1 1 55 annotation1888 1 antisense region for I1030 range1888 1 113 220 annotation1890 1 stem_loop range1890 1 221 255 annotation1889 1 stem_loop range1889 1 56 112 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation1999 1 lac O1 range1999 1 3 19 annotation2001 1 lac O1 range2001 1 26 42 annotation2002 1 -10 range2002 1 43 48 annotation2000 1 -35 range2000 1 20 25 annotation7064 1 BBa_R0011 range7064 1 1 54 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I1032_sequence 1 ataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcactaaaatcaataacttattcttaagtatttgacagcactgaatgtcaaaacaaaacctttcataaattgctttaaggcgacgtgcgtcctcaagctgctcttgtgttaatggtttcttttttgtcgacatcgaaccggtttcctgtcgttgctgttgtgcaaagcttatttcaaccggatgcctggcattcggtttttttt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J07039_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcactaaaatcaataacttattcttaagtatttgacagcactgaatgtcaaaacaaaacctttcataaattgctttaaggcgacgtgcgtcctcaagctgctcttgtgttaatggtttcttttttgtcgacatcgaaccggtttcctgtcgttgctgttgtgcaaagcttatttcaaccggatgcctggcattcggtttttttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z