BBa_J100232 1 BBa_J100232 Sequence of E. Coli ampC promoter region 2015-09-09T11:00:00Z 2015-09-10T12:53:55Z This sequence came from the ampC promoter region in E. coli. This is a promoter with additional CCGC and CGCA sticky ends that will use a Golden Gate Assembly to bind with a functional E. coli plasmid. false false _578_ 28830 28830 9 false This promoter is constitutive; no additional chemicals are necessary, making it ideal for labs with limited resources. false Katie Little annotation2448779 1 -35 box range2448779 1 16 21 annotation2448778 1 -10 box range2448778 1 37 43 BBa_J100232_sequence 1 cgactatcctgacagttgtcacgctgattggtgtcgttacaatctaacgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z