BBa_J15104 1 BBa_J15104 cueR copper-dependent activator coding sequence from E. coli 2007-11-21T12:00:00Z 2015-08-31T04:08:32Z Escherichia coli JM109 CueR is a MerR-family transcriptional regulator protein which regulates the copA promoter of Escherichia coli, activating it in the presence of Cu2+. Reference: Outten FW, Outten CE, Hale J, and O'Halloran TV (2000) Transcriptional activation of an Escherichia coli copper efflux regulon by the chromosomal MerR homologue, CueR. J. Biol. Chem. 275, 31024-31029. false false _163_ 0 837 163 Not in stock false No special considerations false Chris French BBa_J15104_sequence 1 atgaacatcagcgatgtagcaaaaattaccggcctgaccagcaaagccattcgcttctatgaagagaaggggctggtgacgccgccgatgcgcagcgaaaacggttatcgcacctacacgcagcagcatctcaacgaactgaccttactgcgccaggcacggcaggtgggctttaacctggaagagagcggcgagctggtgaatctgtttaacgacccgcagcggcacagcgccgacgtcaaacggcgcacgctggagaaggtggcggagatcgaacgacacattgaggagctgcaatccatgcgcgaccagctgctggcactggcgaatgcctgccctggcgatgacagcgccgactgcccgattatcgaaaatctctccggctgctgtcatcatcgggcagggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z