BBa_J176001 1 flyPCD flyPCD 2011-07-01T11:00:00Z 2015-08-31T04:08:33Z Danio rerio (zebrafish) CBX2 amino acids 2-64. The human codon-optimized coding sequence was synthesized by Genscript. Amino acids 2-64 from the zebrafish CBX2 protein. This is the conserved Polycomb chromodomain predicted to bind trimethylated histone H3 lysine 27 in chromatin. false false _863_ 0 1144 61 Not in stock false Codons were optimized for expression in cultured human cells. false Karmella Haynes BBa_J176001_sequence 1 aatgcgaccgacgatccagtcgatctcgtgtacgcggctgagaaaatcatccaaaagcgcgttaagaagggcgtcgtggagtaccgtgtcaagtggaagggctggaaccagcgctacaacacctgggaaccggaggtaaacatcctggatcgccgcctcatcgacatctacgaacaaacgaacaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z