BBa_J176002 1 fshPCD fshPCD 2011-07-02T11:00:00Z 2015-08-31T04:08:33Z Drosophila Pc protein amino acids 16-78. Human codon optimized sequence was synthesized by Genscript. Polycomb chromodomain from the Drosophila (fruit fly) Pc protein (a.a. 16-78). false false _863_ 0 1144 61 Not in stock false Human codon optimized for expression in human cell culture. false Karmella Haynes BBa_J176002_sequence 1 gaggagctgagcgcggtgggagagcaggtctttgacgccgagtgtatcctcaacaaacgcacgaggaagggcaaactggagtatctggtcaagtggagaggatggtcgtccaagcataacagttgggaacctcaggaaaaccttcttgacccgagactcttggtggcatttaacaagagggagcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z