BBa_J18915 1 3xFLAG 3xFlag tag 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis A 3 repeat FLAG (DYKDDDDK) antigen epitope tag used for marking proteins of interest. Proteins carrying this tag can be easily detected using commercial western blotting reagents. See also: [[BBa_J64005]] false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18915_sequence 1 gattacaaagatgatgatgataaagattataaagatgatgatgataaagattataaagatgatgatgataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z