BBa_J18916 1 StrepII Strep tag II 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET52b gene synthesis Protein purification tag. Bound by Strepavidine (optimized: strepTactin(tm)) and eluted with biotin. Allows for mild and efficient elution. SEE ALSO: * novagen.com, gehealthcare.com (former amersham) for purification protocols * BBa_I757014, StrepTag II from Freiburg iGem team, has three codon variations false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18916_sequence 1 tggagccacccgcagttcgaaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z