BBa_J18928 1 GLucFrag1 Gaussia princeps Luciferase fragment 1 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis N-terminal fragment of H. gaussia luciferase for PCA. '''Disulfide bonds:''' * likely, many Cys in sequence ===Purification=== Inouye & Sahara (2008) discuss the purification and in-vitro activity of different Luciferases, including Gaussia. They indicate that Gaussia Luciferase was previously purified from insoluable fractions -- perhaps due to the high Cys content. Goerke et al (2008) Provide optimized in-vitro expression conditions for Gaussia Luciferase based on tuning the strain from which the cell-free lysate is produced. ===References=== http://www.ncbi.nlm.nih.gov/pubmed/17099704 Remy I, Michnick SW. (2006) A highly sensitive protein-protein interaction assay based on Gaussia luciferase. http://nar.oxfordjournals.org/cgi/content/full/27/13/e4#hd1 Maroun M, Aronheim A. (2007) A novel in vivo assay for the analysis of protein-protein interaction. PMID: 10373602 http://www.ncbi.nlm.nih.gov/pubmed/19373229 Tannous BA. (2009) Gaussia luciferase reporter assay for monitoring biological processes in culture and in vivo. http://www.ncbi.nlm.nih.gov/pubmed/18789309 Inouye S, Sahara Y. (2008) Soluble protein expression in E. coli cells using IgG-binding domain of protein A as a solubilizing partner in the cold induced system. http://www.ncbi.nlm.nih.gov/pubmed/18555198 Goerke AR, Loening AM, Gambhir SS, Swartz JR. (2008) Cell-free metabolic engineering promotes high-level production of bioactive Gaussia princeps luciferase. false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18928_sequence 1 aaaccgaccgaaaacaacgaagattttaacattgtggcggtggcgagcaactttgcgaccaccgatctggatgcggatcgtggcaaactgccgggcaaaaaactgccgctggaagtgctgaaagaaatggaagcgaacgcgcgtaaagccggttgcacccgtggctgcctgatttgcctgagccatattaaatgcaccccgaaaatgaaaaaatttatcccgggtcgttgccatacctatgaaggcgataaagaaagcgcgcagggcggcattggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z