BBa_J202003 1 BBa_J202003 PBAD Mutant#4 2012-07-25T11:00:00Z 2015-08-31T04:08:37Z This mutant was created by random mutagenesis. Released HQ 2013 This is PBAD (BBa_I13453) mutant. -63(T to C), -42 (C to A), and +9 (T to A) relative to the araC transcriptional start site were changed. false false _910_ 0 11164 9 In stock false In order to regulate transcription from PBAD, araC binds three different sites called araO2, araI1, and araI2. In the absence of L-arabinose, araC binds both araO2 and araI1 and bends DNA preventing transcription from PBAD. In the presence of L-arabinose, however, araC has a conformational change because of L-arabinose and binds araI1 and araI2, enabling transcription from PBAD. Like the wild-type (I13453), this part does not have araO2 site which is essential for araC repressor function. Therefore, araC acts as an activator in the presence of L-arabinose. false Jiyeon Park annotation2178427 1 araI1 range2178427 1 40 56 annotation2178426 1 Transcription Start range2178426 1 112 112 annotation2178429 1 Mutation 1 range2178429 1 49 49 annotation2178431 1 Mutation 3 range2178431 1 120 120 annotation2178428 1 araI2 range2178428 1 61 77 annotation2178430 1 Mutation 2 range2178430 1 70 70 BBa_J202003_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcattttcatccataagattagcggatcatacctgacgctttttatcgcaactctctactgtttctccataccgttttattgggctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z