BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23000 1 BBa_J23000 [RBS][TraJf][TT] 2006-06-11T11:00:00Z 2015-08-31T04:08:38Z [Bla][pMB1][RBS][TraJf]+[TT] Digest pSB1A2-J01052 (SpeI/AlwNI, Neb2, Large-2241) Digest pSB1A2-B0015 (AlwNI/XbaI, Neb2, Small-683) Intermediate construct [RBS][TraJf]+[TT] false false _52_ 0 483 52 Not in stock false N/A false John Anderson component1880703 1 BBa_B0010 component1880701 1 BBa_B0034 component1880702 1 BBa_J01000 component1880705 1 BBa_B0012 annotation1880701 1 BBa_B0034 range1880701 1 1 12 annotation1880703 1 BBa_B0010 range1880703 1 717 796 annotation1880702 1 BBa_J01000 range1880702 1 19 708 annotation1880705 1 BBa_B0012 range1880705 1 805 845 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J01000 1 TraJF TraJF controls conjugative transfer in F plasmid 2005-10-17T11:00:00Z 2015-08-31T04:08:11Z TraJF controls conjugative transfer in F plasmid false false _13_ 0 395 13 Not in stock false false Berkeley iGEM 2005 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J01000_sequence 1 atgtatccgatggatcgtattcaacaaaaacatgctcgtcaaatagatctgctggaaaatctgacggcagttattcaggattatccaaatccagcctgtatcagggacgaaactggaaaatttattttttgcaatacgctgtttcatgagtcatttcttacacaagatcaaagtgctgaaaaatggcttctgtcgcagagagatttttgtgaattgatctctgtcacagagatggaagcatataggaatgagcatacgcatcttaatcttgtagaggatgtttttattcagaatagattctggacaatatctgtccagtcatttcttaatggacacagaaatattattctgtggcaattttatgatgctgctcatgttcgtcataaagacagttataatcaaaaaacgattgtcagtgatgatatcagaaatataatcagaagaatgagtgatgattcttctgtatcatcatatgtaaatgatgtcttttacttatatagcaccggaatcagtcataatgctatagcaagaatattaaatatatccatctccacatcaaagaaacacgcatctctgatatgcgactacttctctgtttctaataaagatgagttaattatcttactctacaataaaaagtttatttattatttatacgagaaggctatgtgtatcataaatacgcgttaa BBa_B0034_sequence 1 aaagaggagaaa BBa_J23000_sequence 1 aaagaggagaaatactagatgtatccgatggatcgtattcaacaaaaacatgctcgtcaaatagatctgctggaaaatctgacggcagttattcaggattatccaaatccagcctgtatcagggacgaaactggaaaatttattttttgcaatacgctgtttcatgagtcatttcttacacaagatcaaagtgctgaaaaatggcttctgtcgcagagagatttttgtgaattgatctctgtcacagagatggaagcatataggaatgagcatacgcatcttaatcttgtagaggatgtttttattcagaatagattctggacaatatctgtccagtcatttcttaatggacacagaaatattattctgtggcaattttatgatgctgctcatgttcgtcataaagacagttataatcaaaaaacgattgtcagtgatgatatcagaaatataatcagaagaatgagtgatgattcttctgtatcatcatatgtaaatgatgtcttttacttatatagcaccggaatcagtcataatgctatagcaagaatattaaatatatccatctccacatcaaagaaacacgcatctctgatatgcgactacttctctgtttctaataaagatgagttaattatcttactctacaataaaaagtttatttattatttatacgagaaggctatgtgtatcataaatacgcgttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z