BBa_J23078 1 BBa_J23078 [lock3i] 2006-09-12T11:00:00Z 2015-08-31T04:08:39Z <tt> PCR ca1028F/G00101 on pJ23006-J23032 . . . (162 bp, XbaI/PstI)<br> Sub into pSB1A2-I13521 . . . . . . . . . . (XbaI/PstI)<br> Product is pSB1A2-J23078<br> </tt> lock3d derivative with a 5' extension. This is the basic part, J23077 is the RFP reporter. false true _52_ 0 483 95 It's complicated false N/A false John Anderson BBa_J23078_sequence 1 tgtagaccgaactagaatcacctcttgcttttgggtaagacagaagaggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z