BBa_J23070 1 BBa_J23070 Ser2 derived key 2006-08-16T11:00:00Z 2015-08-31T04:08:39Z Ser2 tRNA and J23060 contains the J23060 loop on a tRNA. more on this later false false _52_ 0 936 52 In stock true no true bryan hernandez annotation1897361 1 loop range1897361 1 37 74 annotation1897362 1 binding site range1897362 1 43 69 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J23081 1 BBa_J23081 [Ser2 tRNA Key(-23)][b0015] 2006-09-23T11:00:00Z 2015-08-31T04:08:40Z J23070 This is the short version of the tRNA key (J23070) with a B0015 double terminator on the end. false false _52_ 0 936 52 Not in stock false none false bryan hernandez component1902356 1 BBa_B0010 component1902358 1 BBa_B0012 component1902355 1 BBa_J23070 annotation1902355 1 BBa_J23070 range1902355 1 1 130 annotation1902356 1 BBa_B0010 range1902356 1 139 218 annotation1902358 1 BBa_B0012 range1902358 1 227 267 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23070_sequence 1 ggagagatgccggagcggctgaacggaccgggatccataaaaacccaaaagcaagaggtgattctagttaaaaaagcttcccggagtaggggcaactctaccgggggttcaaatccccctctctccgcca BBa_J23081_sequence 1 ggagagatgccggagcggctgaacggaccgggatccataaaaacccaaaagcaagaggtgattctagttaaaaaagcttcccggagtaggggcaactctaccgggggttcaaatccccctctctccgccatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z