BBa_J31001 1 Hin LVA DNA invertase Hin tagged with LVA 2006-07-11T11:00:00Z 2015-08-31T04:08:45Z Salmonella typhimurium and the the Hin part without LVA. This part produces the Hin protein with an LVA degredation tag. We are currently looking into this as a way to ensure no Hin is floating around once we turn off the Hin promoter. false false _61_ 0 918 61 In stock true None really false Erin Zwack, Sabriya Rosemond annotation1910566 1 LVA range1910566 1 571 609 annotation1910565 1 Fwd primer J31001 range1910565 1 1 3 annotation1910564 1 Hin range1910564 1 1 570 annotation1910570 1 Rev primer J31001 range1910570 1 551 612 annotation1910567 1 Stop codon range1910567 1 610 612 BBa_J31001_sequence 1 atggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaggaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgagcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgcagcgtgaaaaacctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaattgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacagacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaactagctattatttttggtattggcgtatctaccttatacagatattttccggcaagccgtataaaaaaacgaatgaataggcctgctgcaaacgacgaaaactacgctttagtagcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z